AAV Packaging Services
Adeno-associated virus (AAV) is a non-pathogenic single-stranded DNA virus. Several features of AAV position them as an exceptional experimental tool as well as an attractive candidate for genetic payload delivery in Gene and Cell Therapies. Notable features include:
1. AAV are not currently known to cause any disease;
2. AAV infection results in a very mild immune response;
3. AAV are capable of infecting both dividing and non-dividing cells;
4. recombinant AAV (rAAV) are capable of integrating a gene of interest (GOI) into a cells genome for prolonged and stable expression. In addition, differences in the capsid structure of various AAV serotypes bias infection rates across host cell-types, and provide a mechanism for a degree of cell type infection specificity.
PackGene provides superior quality AAV packaging services to support your AAV-based programs. We have developed a series of proprietary technologies that greatly improve AAV production outcomes including titer, purity, potency, and consistency.
We offer multiple serotypes to meet your research needs, and strive to achieve rapid turnaround and affordable prices while maintaining the highest quality. We are committed to delivering AAVs at guaranteed quantities and within the quoted project lead time. In a case where our quantity and efficiency guarantee is not met, we will refund 5% of the total order cost as an account credit that may be applied to your next order.
Our Advantages
| Fast Turnaround: | 12-15 business days for AAV 5E+13GC |
| Guaranteed Titer: | ≥1E+13GC/mL, based on qPCR genome copies/ml |
| High Purity: | ≥95% |
| High Yield: | up to 1E+16 GC |
| Low Endotoxin: | <10EU/ml, suitable for in vivo experiments |
| Low Empty Shell: | <30% |
| Multiple Serotypes: | 18+ different serotype options available |
| Extensive Experience: | Successfully delivered over 10,000 custom AAV projects |
| Experienced Technical Support: | PhD-level team with years of AAV experience |
Price and Turnaround
*The indicated titers are guaranteed except when the insert exceeds the packaging capacity (4.7 kb) or if you choose to provide us with your own modified rep/cap plasmid or helper plasmid.
| AAV Packaging Serotypes | Guaranteed Yield (GC)* |
List Price (USD) |
Lead Time (Business Day) |
| Normal-yield AAV Serotypes | 2E+12 GC | From $1,494 | 12-15 Days |
| 5E+12 GC | |||
| 1E+13 GC | |||
| 2E+13 GC | |||
| 5E+13 GC | |||
| 1E+14 GC | |||
| 2E+14 GC | From $21,389 | 18-24 Days | |
| 5E+14 GC | |||
| 1E+15 GC | From $92,689 | 30-45 Days | |
| 2E+15 GC | |||
| Low-yield AAV Serotypes (AAV2, 4, 6, etc.) |
2E+12 GC | From $1,839 | 12-15 Days |
| 5E+12 GC | |||
| 1E+13 GC | |||
| 2E+13 GC | |||
| 5E+13 GC | |||
| 1E+14 GC | From $21,389 | 18-24 Days | |
| 2E+14 GC | |||
| 4E+14 GC |
Note:
- GC = Genome copies.
- For these extremely low-yield AAV serotypes without production data, we are not able to guarantee the final yield or titer specified here.
A variety of AAV-based QC assays have been developed by PackGene’s experienced QC team to verify the identity, purity, and potency of AAV viral particles for in vivo studies. The AAV genome copies are quantified via SYBR qPCR with ATCC’s Reference AAV for titer calibration. Purity is determined by Coomassie-Blue staining.
We guarantee the endotoxin level of the AAV particles lower than 10 EU/ml. We also offer additional QC tests including ddPCR, TEM, TCID50 tittering and other QC services. Please check AAV Analytical Services to learn more.
| Category | QC Assays | QC Standard |
| Identity | Identity – GOI Sequence | Additional QC |
| Purity | SDS-PAGE Coomassie Blue Staining | Free QC |
| TEM | Additional QC | |
| AUC | Additional QC | |
| Potency & Content | qPCR | Free QC |
| ddPCR | Additional QC | |
| TCID50 | Additional QC | |
| Capsid Titer-ELISA | Additional QC | |
| Impurity | Endotoxin Test | Free QC |
| Mycoplasma Detection | Additional QC | |
| Sterility Test | Additional QC | |
| Residual Plasmid Test | Additional QC |
1. Standard QC
① Restriction digestion analysis using multiple endonuclease to verify the plasmids to be used for AAV packaging.
② AAV Titering by qPCR (SYBR Green with standard curve for quantification)
Note: ATCC VR-1816™ was used as the standards for AAV qPCR titering.
③ AAVpurity analysis by SDS-PAGE and Coomassie Staining (silver staining available upon request)
Legend: Lanes 2-5 and 7-1: AAV samples produced at PackGene. Lane 1,6: Marker）
④ Endotoxin Test by LAL assay
2. Other available analytical tests
① HPLC purity analysis
AAV2-EGFP Sample produced at PackGene. The purity as analyzed by HPLC was 99%.
② TEM
AAV Production Workflow
Storage Requirements
- Store the virus at -80°C, take it out when needed, and place it on ice during operation. Fast Service must be used within 24 hours.
- Calculate the usage in advance, and PackGene will aliquot the virus according to the pre-determined requirements before shipping to avoid thawing and re-freezing after receiving the your AAVs as freeze thaw cycles influence virus viability. If aliquoting is required, it is recommended to use PCR tubes with siliconized inner walls, or special virus preservation tubes with low protein binding rates.
- Melt the virus in an ice bath and dilute with PBS or PBS / 0.001% F-68 if needed.
Case Study
Injection Method: Intratracheal Injection
Recommended Dose: 1×10^10vg/ml
Targeting Site: Lung
Animal Model: C57BL/6 BMP4+/+ and BMP4+/−mice
Journal: European respiratory journal, 2022 (IF=33.795)
Paper Title: Bone morphogenetic protein 4 inhibits pulmonary fibrosis by modulating cellular senescence and mitophagy in lung fibroblasts
DOI: 10.1183/13993003.02307-2021
Injection Method: 300nl was injected bilaterally into the anterior cingulate cortex
Recommended Dose: 50ul, 5×10^11GC/ml
Targeting Site: Anterior Cingulate Cortex
Animal Model: Global Shank3 KO and Conditional ACC Shank3 KO Mouse Model
Journal: Nature Neuroscience, 2022 (IF=28.771)
Paper Title: Anterior cingulate cortex dysfunction underlies social deficits in Shank3 mutant mice
DOI: https://doi.org/10.1038/s41593-019-0445-9
To minimize offtarget effects, three guide RNAs (gRNA1: GGGCTATTCCAGCCTCCCTCC; gRNA2: GGCAGGGGCGTGTCCAGGTTAG; gRNA3: TTGGCGGCCCACACG GGCGCGG) corresponding to SHANK3 were designed using the CRISPR design tool (http://www.rgenome.net/cas-designer/) and cloned into pX601-AAVCMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA… After the plasmids were confirmed by sequencing, we transfected those constructs into N2A mouse cells. A T7E1 assay was performed to evaluate indel efficiency at 72h after transduction. We then chose gRNA2, which had the best efficiency, to package in AAV serotype 8 (PackGene Biotech) for administration to the mice.
AAV In Vivo Delivery & Experiment Design
Pre-experimental Design Reference
- Serotype selection: If you are still not sure which serotype is most suitable for your experimental material, we advise that you test more than 3 fluorescent AAV serotypes for pre-infection experiments.
There are more than 10 AAV serotypes and variants have been discovered or created. We provide the mostly applied AAV serotypes for packaging. Each serotype presents its unique tissue-tropism profile. Until now, AAV9, AAVrh10 and newly emerging AAVPHP.B are ideal for systemically delivery or crossing Blood-Brain-Barrier into the brain (basically mouse, AAVPHP.B is not yet examined in Non-Human Primates); AAV DJ is the best choice for in vitro experiment for its broad and high infectiousness in most cell lines. Check Table 1 below as references for your experiment design (the red mark means highly recommended, but majorly depends on your experiment design), or you can contact us for technical support.
Liver Heart SK muscle Eye CNS CNS (BBB) Pancreas Lung T,B, Dendrital Cell AAV1 √ √ √ AAV2 √ √ √ √ AAV3 √ √ √ √ AAV4 √ √ √ AAV5 √ √ √ √ AAV6 √ √ √ AAV7 √ √ AAV8 √ √ √ √ AAV9 √ √ √ √ √ √ √ √ AAVrh10 √ √ √ √ √ √ √ √ AAVDJ √ √ AAVPHP.B √ √ - Gradient dilution infection: Due to the differences in length and expression levels of different genes, we strongly recommend that you perform 3-4 AAV gradient dose injections to detect the target gene expression level before the formal experiment.
- Experimental control: We advise the use of a GFP positive control vector with the same serotype and promoter as your experimental vector.
AAV in Vitro Infection
- Serotype selection: For cells cultured in vitro, AAV-DJ and AAV6 are the most common choices. In conventional cell culture, AAV-DJ can infect more than 80% of cells, while AAV6 has the strongest infective potency against blood-derived cells.
- Gradient dilution infection: We strongly recommend that you perform a gradient concentration infection pre-experiment (at least 3-4 gradients, e.g. MOI=1×10^3,MOI=1×10^4,MOI=1×10^5) prior to formal experimentsin order to test expression levels and verify that your experimental dose is not cytotoxic.
- Assay time:usually 2-7 days after infection.