Adeno-associated virus (AAV) is a non-pathogenic single-stranded DNA virus. Several features of AAVs position them as an exceptional research tool as well as an attractive candidate for genetic payload delivery in Gene and Cell Therapies. Notable features include: (1) AAV are not currently known to cause any disease, (2) AAV infection results in a very mild immune response, (3) AAV are capable of infecting both dividing and non-dividing cells, and (4) recombinant AAV (rAAV) are capable of driving prolonged expression of a gene of interest (GOI) without integrating the GOI into the host genome. In addition, differences in the capsid structure of various AAV serotypes bias infection rates across host cell-types and therefore provide a mechanism for tissue or cell-type infection specificity.
PackGene provides superior quality AAV packaging services to support your AAV-based programs. We have developed a series of proprietary technologies that greatly improve AAV production outcomes including titer, purity, potency, and consistency.
We offer multiple serotypes to meet your research needs, and we strive to achieve rapid turnaround and affordable prices while maintaining the highest quality. We are committed to delivering AAVs at guaranteed quantities and within the quoted project lead time. In a case where our quantity and efficiency guarantee is not met, we will refund 5% of the total order cost as an account credit that may be applied to your next order.
Fast Turnaround
12-15 business days for AAV 5E+13GC
Guaranteed Titer
≥1E+13GC/mL (qPCR genome copies/ml)
High Purity
≥95%
High Yield
up to 1E+16 GC
Low Endotoxin
<10EU/ml, suitable for in vivo experiments
Low Empty Shell
<30%
Multiple Serotypes
18+ different serotype options available
Extensive Experience
Experienced Technical Support
PhD-level team with years of AAV experience
*The indicated titers are guaranteed except when the insert exceeds the packaging capacity (4.7 kb) or if you choose to provide us with your own modified rep/cap plasmid or helper plasmid.
If you would like to use any AAV serotypes that are currently under patent, and your application is for commercial use, we advise that you contact the patent owner to obtain authorization beforehand.
| AAV Packaging Serotypes | Guaranteed Yield (GC)* | Lead Time (Dusiness Day) |
| Normal-yield AAV Serotypes | 2E+12 GC | 12-15 Days |
| 5E+12 GC | ||
| 1E+13 GC | ||
| 2E+13 GC | ||
| 5E+13 GC | ||
| 1E+14 GC | ||
| 2E+14 GC | 18-24 Days | |
| 5E+14 GC | ||
| 1E+15 GC | 30-45 Days | |
| 2E+15 GC | ||
| Low-yield AAV Serotypes (AAV2, 4, 6, etc.) |
2E+12 GC | 12-15 Days |
| 5E+12 GC | ||
| 1E+13 GC | ||
| 2E+13 GC | ||
| 5E+13 GC | ||
| 1E+14 GC | 18-24 Days | |
| 2E+14 GC | ||
| 4E+14 GC |
- GC = Genome copies.
- For these extremely low-yield AAV serotypes without production data, we are not able to guarantee the final yield or titer specified here.
A variety of AAV-based QC assays have been developed by PackGene’s experienced QC team. QC tests are aimed at verification of the identity, purity, and potency of AAV viral particles for both in vitro and in vivo studies. AAV genome copies are quantified via SYBR qPCR with ATCC’s Reference AAV for titer calibration. Purity is determined by Coomassie-Blue staining.
We guarantee the endotoxin level of the AAV particles lower than 10 EU/ml. We also offer additional QC tests including ddPCR , TEM, TCID50 tittering and other QC services. Please check AAV Analytical Services to learn more.
| Category | QC Assays | QC Standard |
| Identity | Identity – GOI Sequence | Additional QC |
| Purity | SDS-PAGE Coomassie Blue Staining | Free QC |
| TEM | Additional QC | |
| AUC | Additional QC | |
| Potency & Content | qPCR | Free QC |
| ddPCR | Additional QC | |
| TCID50 | Additional QC | |
| Capsid Titer-ELISA | Additional QC | |
| Impurity | Endotoxin Test | Free QC |
| Mycoplasma Detection | Additional QC | |
| Sterility Test | Additional QC | |
| Residual Plasmid Test | Additional QC |
Restriction digestion analysis using multiple endonuclease to verify the plasmids to be used for AAV packaging.
AAV Titering by qPCR (SYBR Green with standard curve for quantification)
Note: ATCC VR-1816™ was used as the standards for AAV qPCR titering.
Endotoxin Test by LAL assay
AAV purity analysis by SDS-PAGE and Coomassie Staining (silver staining available upon request)
Legend: Lanes 2-5 and 7-1: AAV samples produced at PackGene. Lane 1,6: Marker
HPLC purity analysis
AAV2-EGFP Sample produced at PackGene. The purity as analyzed by HPLC was 99%.
TEM
Storage Requirements
- Store the virus at -80°C, and place it on ice during operation.
- Calculate your expected usage in advance and PackGene will aliquot your virus according to your pre-determined requirements. This can help avoid unnecessary thawing and re-freezing after receiving your AAVs since freeze thaw cycles influence virus viability. If aliquoting is required, it is recommended to use PCR tubes with siliconized inner walls, or special virus preservation tubes with low protein binding rates.
- Thaw your virus aliquots in an ice bath immediately before use.
- Dilute with PBS or PBS / 0.001% F-68 if needed.
Case Study
Injection Method: Intratracheal Injection
Recommended Dose: 1×10^10vg/ml
Targeting Site: Lung
Animal Model: C57BL/6 BMP4+/+ and BMP4+/−mice
Journal: European respiratory journal, 2022 (IF=33.795)
Paper Title: Bone morphogenetic protein 4 inhibits pulmonary fibrosis by modulating cellular senescence and mitophagy in lung fibroblasts
DOI: 10.1183/13993003.02307-2021
Injection Method: 300nl was injected bilaterally into the anterior cingulate cortex
Recommended Dose: 300nl was injected bilaterally into the anterior cingulate cortex
Targeting Site: Anterior Cingulate Cortex
Animal Model: Global Shank3 KO and Conditional ACC Shank3 KO Mouse Model
Journal: Nature Neuroscience, 2022 (IF=28.771)
Paper Title: Anterior cingulate cortex dysfunction underlies social deficits in Shank3 mutant mice
DOI: https://doi.org/10.1038/s41593-019-0445-9
To minimize offtarget effects, three guide RNAs (gRNA1: GGGCTATTCCAGCCTCCCTCC; gRNA2: GGCAGGGGCGTGTCCAGGTTAG; gRNA3: TTGGCGGCCCACACG GGCGCGG) corresponding to SHANK3 were designed using the CRISPR design tool (http://www.rgenome.net/cas-designer/) and cloned into pX601-AAVCMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA… After the plasmids were confirmed by sequencing, we transfected those constructs into N2A mouse cells. A T7E1 assay was performed to evaluate indel efficiency at 72h after transduction. We then chose gRNA2, which had the best efficiency, to package in AAV serotype 8 (PackGene Biotech) for administration to the mice.
AAV In Vivo Delivery & Experiment Design
As an effective tool for delivering exogenous genes, rAAV are being used by a rapidly increasing number of in vivo researchers. Nevertheless, the ideal injection site, rAAV quantity, rAAV concentration, and incubation period may vary across experiments and scientific fields. Due to this variability, it is difficult to adopt a universal AAV injection protocol that is applicable for all experiments. Clients must therefore explore each of these variables independently based on their specific goals.
Pre-experimental Design Reference
- Serotype selection: If you are unsure which AAV serotype is most suitable for your experiments, we advise that you test the infection rates of 3 or more different serotypes in your experimental system with our rAAV fluorescent reporter constructs.
- Gradient dilution infection: The level of transgene expression driven by rAAV may vary substantially across different genes. We therefore recommend that you perform 3-4 AAV gradient dose injections to determine the ideal gene expression level for each rAAV before performing any formal experiments.
- Experimental control: We advise the use of a GFP positive control vector of the same serotype and promoter as your experimental vector.
AAV in Vitro Infection
- Serotype selection: For cells cultured in vitro, AAV-DJ and AAV6 are the most common choices. In conventional cell culture, AAV-DJ can infect more than 80% of cells, while AAV6 has the strongest infective potency against blood-derived cells.
- Gradient dilution infection: The level of transgene expression driven by rAAV may vary substantially across different genes. We therefore recommend that you perform 3-4 AAV gradient dose injections to determine the ideal gene expression level for each rAAV before performing any formal experiments and to verify that your experimental dose is not cytotoxic.
- Assay time: usually 2-7 days after infection.
What is the maximum size of an rAAV transgene?
The upper limit of rAAV genome packaging is ~ 5Kb including the required 145bp ITR sequences at either end. Thus, rAAV accommodate a ~4.5Kb transgene expression cassette. An rAAV transgene expression cassette usually includes a promoter, a gene of interest, and a terminator signal. PackGene’s K104 vector has been designed to maximize gene of interest capacity by integrating the smallest available mammalian promoter region in miniCMV (180 bp) and terminator region (50 bp). PackGene’s K104 vector can thus accept a gene of interest up to 4.4kb in length.
What are rAAV serotypes , and what steps should be taken to ensure that the best serotype is chosen?
Different AAV serotypes are defined by differences in the amino acid sequence and three-dimensional structure of their capsid proteins, and more than 200 AAV serotypes of have been discovered or designed. Serotype specific differences in rAAV capsid proteins correspond with variations in cell surface receptor recognition and binding. This, in turn, results in variations in the infection rate of rAAV serotypes across tissues and cell types.
PackGene’s expert technical team is available to help you determine the optimum serotype for your experiments based on the literature regarding rAAV serotype infection rates and our own internal testing. Nevertheless, for target cell types or tissues without substantial literature available, we may recommended the execution of pilot experiments using reporter transgenes to determine the most ideal serotype.
What information will I need to provide to place a custom rAAV vector construction order?
Custom AAV vector construction projects can be generated in several ways, and our expert technical team is available to help in the design process. There are several questions that you may prepare answers for to expedite the design process, they are:
- Do you have a transgene template?
- If so, please provide your gene template to us for verification.
- Do you want to overexpress a gene without a template?
- If so, please provide the gene number, sequence map, host species, and gene length.
- Do you want to generate rAAVs for the manipulation of gene expression using techniques such as RNAi or CRISPR?
- If so please provide us with the target gene number, host species, and gene length.
- Is there a specific promoter sequence you would like to use?
- Is there a specific fluorescent tag or reporter that you would like to use?
- Will several transgenes need to be co-expressed simultaneously?
- Is your total transgene sequence length <4.4kb?
What information will I need to provide to place a custom rAAV packaging order?
Custom AAV packaging projects can be generated in several ways, and our expert technical team is available to help in the design process. There are several questions that you may prepare answers for to expedite the design process, they are:
- Do you know which serotype you would like you use for your project?
- Our expert team is available to help guide your selection if you would like, but you may alternatively find your ideal serotype by looking toward the literature within your field.
- Are you confident that your preferred serotype is capable of infecting the cells that you plan to use for your experiments?
- If not, we offer fluorescent control test kits for screening various serotypes. These can be used to define the infectivity of a given serotype in your cells, or to determine the optimal serotype for your experiments.
- Do you plan to provide your own plasmid for packaging?
- If so, please make sure that you to provide a vector map and full sequence. Additionally, it is best to confirm ITR spacing and to make sure that the plasmid has been fully sequenced to avoid complications associated with common mutations that can be driven by the presence of ITRs.
- What are your requirements for the amount, titer, and packaging of the final deliverable rAAV?
One-stop Solutions for All Your AAV Gene Therapy Needs
Related Services / Products
AAV Analytical Services
We are one of the few vendors that can do ALL in-house.
READ MORE
Off the Shelf AAV Products
We offer a wide catalogue of pre-made AAVs for a multitude of research needs.
READ MORE