Cap 1 N1meψ Rluc mRNA

Clear
Add to Quote
SKU: RNAP033 Category:

Description

Renilla luciferase (Renilla Luc), derived from Renilla reniformis (sea pansy), emits light in the presence of the cofactor coelenterazine. Used alongside FLuc mRNA, Renilla Luc mRNA can function as an internal control for investigating the impact of different conditions, such as dosage or chemical modifications, on translation. This mRNA possesses a Cap1 structure, which is highly efficient in capping. It is fully substituted with N1-methyl-pseudo Uridine to improve expression and decrease immunogenicity. Additionally, the mRNA features a 110A tail in its sequence, resembling a mature mRNA.

Gene name

Rluc

Function

Reporter

ORF sequence

ATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATGATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGGCCTGATATTGAAGAAGATATTGCGTTGATCAAATCTGAAGAAGGAGAAAAAATGGTTTTGGAGAATAACTTCTTCGTGGAAACCATGTTGCCATCAAAAATCATGAGAAAGTTAGAACCAGAAGAATTTGCAGCATATCTTGAACCATTCAAAGAGAAAGGTGAAGTTCGTCGTCCAACATTATCATGGCCTCGTGAAATCCCGTTAGTAAAAGGTGGTAAACCTGACGTTGTACAAATTGTTAGGAATTATAATGCTTATCTACGTGCAAGTGATGATTTACCAAAAATGTTTATTGAATCGGACCCAGGATTCTTTTCCAATGCTATTGTTGAAGGTGCCAAGAAGTTTCCTAATACTGAATTTGTCAAAGTAAAAGGTCTTCATTTTTCGCAAGAAGATGCACCTGATGAAATGGGAAAATATATCAAATCGTTCGTTGAGCGAGTTCTCAAAAATGAACAATAA

Species

Renilla

Cellular localization of the protein

Cytosol

Concentration

1mg/mL

Storage Buffer

Rnase Free H2O

Gene length (bp)

936

Molecular Weight (kDa)

523

Storage Temperature

-80°C

Shipping Condition

Dry ice

Appearance

Clear and colorless

Purity

Fragment analysis by capillary electrophoresis

Base Composition

N1meψ

Capping

Cap1

Tag

N-HA

Stock

In stock

Additional information